 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| hsa_circ_0004458 | |||
| Gene | Organism | Human | |
| Genome Locus | Build | hg19 | |
| Disease | Papillary Thyroid Carcinoma (PTC) | ICD-10 | Thyroid and other endocrine glands (D09.3) |
| DBLink | PMID | 30086127 | |
| Experimental Method | |||
| Sample Type | Tissue and cell lines | Comparison | 48 pair of PTC tissue samples (PTC tissues and the matched para-cancerous thyroid tissues |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward GTCCATTGCCTTACCTGTGC ReverseCTGTCCAGCTGATAAAGGCG | Statistics | Fold Change : Upregulated pvalue : <0.05 |
| Citation | |||
| Jin, X, Wang, Z, Pang, W, Zhou, J, Liang, Y, Yang, J, Yang, L, Zhang, Q (2018). Upregulated hsa_circ_0004458 Contributes to Progression of Papillary Thyroid Carcinoma by Inhibition of miR-885-5p and Activation of RAC1. Med. Sci. Monit., 24:5488-5500. | |||